Homologous nucleotide sequences between prokaryotic and eukaryotic mRNAs: The 5'-end sequence of the mRNA of the lipoprotein of the Escherichia coli outer membrane

The sequence of the first 89 nucleotides at the 5' end of the mRNA for the lipoprotein of the E. coli outer membrane is: GCUACAUGGAGAUUAACUCAAUCUAGAGGGUAUUAAUAAUGAAAGCUACUAAACUGGUACUGGGCGCGGUAAUCCUGGGU UCUACUCUG. The sequence of the first 72 nucleotides was established by direct sequencing methods and was extended to 89 residues on the basis of the known sequences of oligonucleotides obtained from complete digestion of the mRNA by ribonuclease T₁ or A and the known amino acid sequence of the prolipoprotein. The mRNA has an untranslated region of 38 residues before the initiation codon, AUG. A unique feature of the 5'-end sequence of the mRNA is that the sequence of 12 nucleotides (GUAUUAAUAAUG) prior to, and including, the initiation codon is the same as that found at the ribosome-binding site for 80S ribosomes in brome mosaic virus RNA4, a eukaryotic mRNA.