Homologous nucleotide sequences between prokaryotic and eukaryotic mRNAs: The 5'-end sequence of the mRNA of the lipoprotein of the Escherichia coli outer membrane

R. M. Pirtle, I. L. Pirtle, M. Inouye

Research output: Contribution to journalArticlepeer-review

20 Scopus citations

Abstract

The sequence of the first 89 nucleotides at the 5' end of the mRNA for the lipoprotein of the E. coli outer membrane is: GCUACAUGGAGAUUAACUCAAUCUAGAGGGUAUUAAUAAUGAAAGCUACUAAACUGGUACUGGGCGCGGUAAUCCUGGGU UCUACUCUG. The sequence of the first 72 nucleotides was established by direct sequencing methods and was extended to 89 residues on the basis of the known sequences of oligonucleotides obtained from complete digestion of the mRNA by ribonuclease T1 or A and the known amino acid sequence of the prolipoprotein. The mRNA has an untranslated region of 38 residues before the initiation codon, AUG. A unique feature of the 5'-end sequence of the mRNA is that the sequence of 12 nucleotides (GUAUUAAUAAUG) prior to, and including, the initiation codon is the same as that found at the ribosome-binding site for 80S ribosomes in brome mosaic virus RNA4, a eukaryotic mRNA.

Original languageEnglish (US)
Pages (from-to)2190-2194
Number of pages5
JournalProceedings of the National Academy of Sciences of the United States of America
Volume75
Issue number5
DOIs
StatePublished - 1978

All Science Journal Classification (ASJC) codes

  • General

Fingerprint Dive into the research topics of 'Homologous nucleotide sequences between prokaryotic and eukaryotic mRNAs: The 5'-end sequence of the mRNA of the lipoprotein of the Escherichia coli outer membrane'. Together they form a unique fingerprint.

Cite this